Skip to main content

Table 2 Selected SNPs and their relevant information. Reported Minor Allele Frequency and predicted consequence were obtained from http://www.ncbi.nlm.nih.gov/snp/, NCBI

From: Sequence analysis and variant identification at the APOC3 gene locus indicates association of rs5218 with BMI in a sample of Kuwaiti’s

SNPPosition (GRCh38.p12)ConsequenceGenomAD reported MAFContext sequence
rs5128
(C3238G)
chr11:116832924
g.8017G > C
3’UTR VariantG = 0.16051 (39,468/245886)AAGTCCACCTGCCTATCCATCCTGC [C/G]AGCTCCTTGGGTCCTGCAATCTCCA
rs2854117
(C-482 T)
chr11:116829426
g.4519 T > C
5’UTR Transcript VariantC = 0 0.4163 (12,835/30834)AGGCCTTGCCGGAGCCACTGATGCC [T/C]GGTCTTCTGTGCCTTTACTCCAAAC
rs2070668
(T528G)
chr11:11683043
g.5530 T > G
Intron (1) VariantG = 0.4314 (13,268/30758)[T/G]AGCAGGGAGCCGGCCCCTACTCCTT
KUAPOC3N2chr11:116700819
g.5196 A > G
Intron (1) VariantN/ACustom Designed NovelSNP2:
Forward: GGTCCTCAGTGCCTGCTG
Reverse:TCTAGGGATGAACTGAGCAGACA
KUAPOC3N3chr11:116701159
g. 5536G > A
Intron (1) VariantN/ACustom Designed NovelSNP3:
Forward: CCCCCACCCCTCATCATAAC
Reverse: CTATGTAGCTTTGGGCAAGTGA
  1. SNP Single nucleotide polymorphism, 3′UTR 3′-untranslated region, 5′UTR 5′-untranslated region, N/A Not available