Skip to main content

Table 1 The sequence of primers used for gene expression study and for bisulfate sequencing study

From: Oleic acid influences the adipogenesis of 3T3-L1 cells via DNA Methylation and may predispose to obesity and obesity-related disorders

GeneSequenceLocation in the geneProduct length [bp]R2**
Β-actinFCCCAGATCATGTTTGAGACC2/3*530,99
RCTGGATGGCTACGTACATG
Dnmt1FATGAGAGGGAGGAGAAGAGAC9/10*1840,99
RTGCTGCTGGTACTTCAGGTTAG
Dnmt3aFCTCAGTGGTGTGTGTGGAGA2/3*1960,98
RCACTTCCACAGCCTTGCCACT
C/ebpαFGACTGGAGTTATGACAAGCTTC1*1070,99
RTGCACACTGCCATTGCACAAG
C/ebpβFATCCGGATCAAACGTGGCT1*1070,99
RAACCCCGCAGGAACATCTTT
C/ebpδFCGAATCGCTAGTTTCTTTGGG1*750,99
RATAGCTTCTCTCGCAGTCCAG
PparγFATGTCTCACAATGCCATCAGG4/5*980,99
RTCTGGGTTCAGCTGGTCGAT
InsrFCCAGGCATCGTGTGAAAATG6/7*1600,99
RCTCTGTCACATTCTGATAAG
Slc2a4FCAGGCATCAATGCTGTTTTC7/8*1090,99
RGTGAAGACCGTATTGACCAC
LepFTTCACACACGCAGTCGGTAT1/2*840,99
RGACAAACTCAGAATGGGGTG
AdipoqFAGGAGATGCAGGTCTTCTTG1/2*1370,99
RCTGAGCGATACACATAAGC
Ptpn1FAAAACCTGACTACCAAGGAG5/6*550,99
RCATGTGGTGTAGTGGAAATG
Pik3r1FGACATCTCAAGGGAAGAAGT2/3*1060,99
RGTGTAAGAGTGTAATCGCCG
Akt1FCATTCAGACTGTGGCAGATG4/5*1450,99
RAAACTCGTTCATGGTCACAC
FasnFTTGATGATTCAGGGAGTGG4/5*1260,99
RTGCTGCCATCTGTATTGGTGC
AcacaFCTTAGAGAGGGGTCAAGTC14/15*1490,99
RCTTCCACACACGAGCCATTC
Scd1FCCCACATGCTCCAAGAGATC1/2*1270,99
RTCAGGACGGATGTCTTCTTCC
LplFTCAACTGGATGGAGGAGGAG3/4*1030,99
RTTGGTCAGACTTCCTGCTAC
Il-6FGATACCACTCCCAACAGACC2/3*990,98
RGCACAACTCTTTTCTCATTTC
Il-10FTAAGGGTTACTTGGGTTGCC2/3*1440,92
RCGCATCCTGAGGGTCTTCA
C/ebpαFTAGAAGGTGTTGGAGTTGATTAGTG937–1140 bp193 
RCCTCTAAATCTCCAACCAAAAAAC
PparγFTTAGAGGAAGGTAAATTTTTGATAG− 1925 -
− 1706 bp
219 
RAAACAATCACCCTATCAATCACAC
  1. * Number of the exon/ exon junction
  2. ** primers efficiency assessed based on standard curve method