Skip to main content

Table 1 Primer sequences for GUCY1A3 SNaPshot genotyping

From: Associations between GUCY1A3 genetic polymorphisms and large artery atherosclerotic stroke risk in Chinese Han population: a case-control study

Primer descriptionSequence
rs1842896 PCR primerForward: GAATTATACAGTTACTTGCCTCAGGTTGAC
Reverse: GAAAAGGCAGATTAAGATGACGGATTT
rs7692387 PCR primerForward: CACTTCACTGTGGAAACCGAGTTG
Reverse: CAAAGCAAGTAAGGCAGAGAACAAGA
rs1842896 SR1 primerCATGATAACTAGTGCTTTTAAGGGAATG
rs1842896 SR2 primerTTTTTTTTTTTTCATGATAACTAGTGCTTTTAAGGGAATG
rs1842896 SR3 primerTTTTTTTTTTTTTTTTTTTTTTTTCATGATAACTAGTGCTTTTAA-GGGAATG
rs7692387 SF1 primerGGCCAAGGGCAGAGACATTT
rs7692387 SF2 primerTTTTTTTTTTTTGGCCAAGGGCAGAGACATTT
rs7692387 SF3 primerTTTTTTTTTTTTTTTTTTTTTTTTGGCCAAGGGCAGAGACATTT