Skip to main content

Table 3 Primers and their sequences for PCR analysis

From: Ubiquitin-specific protease as the underlying gene biomarker for aortic stenosis

PrimerSequence (5′–3′)
ACTIN-hFCACCCAGCACAATGAAGATCAAGAT
ACTIN-hRCCAGTTTTTAAATCCTGAGTCAAGC
USP14-hFTGTGCCTGAACTCAAAGATGCC
USP14-hRACTGTCCTTGTTCACCTTTCTCG