Skip to main content

Table 2 Primers utilized in qRT–PCR

From: Elevated cholesteryl ester transfer and phospholipid transfer proteins aggravated psoriasis in imiquimod-induced mouse models

Gene PCR primer
IL-17A F: TATCCCTCTGTGATCTGGGAAG
R: ATCTTCTCGACCCTGAAAGTGA
IL-17F F: CAAGAAATCCTGGTCCTTCG
R: GAGCATCTTCTCCAACCTGAA
IL-22 F: TCATTCAAAGGTGGCCTCAG
R: CAAGGGGAAGGAGAGCCTTA
IL-23 F: CACCTCCCTACTAGGACTCAGC
R: CTGCCACTGCTGACTAGAAC
IL-1 F: ACTGTTTCTAATGCCTTCCC
R: ATGGTTTCTTGTGACCCTGA
IL-6 F: ACCACGGCCTTCCCTACTTC
R: CTCATTTCCACGATTTCCCAG
INF-α F: AGTGAGCTGACCCAGCAGAT
R: CAGGGGCTGTGTTTCTTCTC
GAPDH F: TGACGTGCCGCCTGGAGAAA
R: AGTGTAGCCCAAGATGCCCTTCAG