Mammary inflammation around parturition appeared to be attenuated by consumption of fish oil rich in n-3 polyunsaturated fatty acids

  • Sen Lin1,

    Affiliated with

    • Jia Hou1,

      Affiliated with

      • Fang Xiang1,

        Affiliated with

        • Xiaoling Zhang1,

          Affiliated with

          • Lianqiang Che1,

            Affiliated with

            • Yan Lin1,

              Affiliated with

              • Shengyu Xu1,

                Affiliated with

                • Gang Tian1,

                  Affiliated with

                  • Qiufeng Zeng1,

                    Affiliated with

                    • Bing Yu1,

                      Affiliated with

                      • Keying Zhang1,

                        Affiliated with

                        • Daiwen Chen1,

                          Affiliated with

                          • De Wu1 and

                            Affiliated with

                            • Zhengfeng Fang1Email author

                              Affiliated with

                              Contributed equally
                              Lipids in Health and Disease201312:190

                              DOI: 10.1186/1476-511X-12-190

                              Received: 11 November 2013

                              Accepted: 26 December 2013

                              Published: 31 December 2013

                              Abstract

                              Background

                              Mastitis endangers the health of domestic animals and humans, and may cause problems concerning food safety. It is documented that n-3 polyunsaturated fatty acids (PUFA) play significant roles in attenuating saturated fatty acids (SFA)-induced inflammation. This study was therefore conducted to determine whether mammary inflammation could be affected by consumption of diets rich in n-3 PUFA.

                              Methods

                              Forty-eight rats after mating began to receive diets supplemented with 5% fish oil (FO) or 7% soybean oil (SO). Blood and mammary tissue samples (n = 6) at day 0 and 14 of gestation and day 3 postpartum were collected 9 hours after intramammary infusion of saline or lipopolysaccharide (LPS) to determine free fatty acids (FFA) concentration and FA composition in plasma and inflammation mediators in mammary tissues.

                              Results

                              At day 14 of gestation and day 3 postpartum, the FO-fed rats had lower plasma concentrations of C18:2n6, C20:4n6, total n-6 PUFA and SFA, and higher plasma concentrations of C20:5n3 and total n-3 PUFA than the SO-fed rats. Plasma C22:6n3 concentration was also higher in the FO-fed than in the SO-fed rats at day 3 postpartum. Compared with the SO-fed rats, the FO-fed rats had lower mammary mRNA abundance of xanthine oxidoreductase (XOR) and protein level of tumor necrosis factor (TNF)-α, but had higher mammary mRNA abundances of interleukin (IL)-10 and peroxisome proliferator-activated receptor (PPAR)-γ at day 14 of gestation. Following LPS infusion at day 3 postpartum, the SO-fed rats had increased plasma concentrations of FFA, C18:1n9, C18:3n3, C18:2n6 and total n-6 PUFA, higher mammary mRNA abundances of IL-1β, TNF-α and XOR but lower mammary mRNA abundance of IL-10 than the FO-fed rats.

                              Conclusions

                              Mammary inflammation around parturition appeared to be attenuated by consumption of a diet rich in n-3 PUFA, which was associated with up-regulated expression of IL-10 and PPAR-γ.

                              Keywords

                              Mastitis n-3 PUFA Inflammatory cytokines IL-10 PPAR-γ

                              Background

                              Udder health is pivotal to productivity, antibiotic use and animal welfare [1]. Mastitis threatens the health of mammals all over the world including humans. For the dairy industry, mastitis is the most costly common disease, and the economic loss due to mastitis in dairy cattle is estimated at $185/cow/year in the United States [2]. For the pork industry, the infection of the mammary glands results in reduced productivity of sows and increased mortality of piglets [3]. Up to a third of lactating women will become ill because of mastitis [4]. The occurrence of mastitis is characterized by redness, swelling, and pain. However, without these symptoms, subclinical mastitis can also endanger the health of mammals, characterized by a high somatic cell count [5]. Owing to its invisible characteristic, subclinical mastitis may be neglected and bring even larger economic loss. The current method to treat mastitis is to use antibiotics [6], which may lower the quality of animal products, and threaten the health of humans. Thus, new methods dealing with clinical and subclinical mastitis are urgently needed.

                              It is generally considered that exogenous pathogens are the main causes of mastitis, as E.coli and staphylococcus have been confirmed to play key roles in inducing mastitis in domestic animals [6, 7]. These microorganisms may activate the mammary innate immune systems and thus cause inflammatory responses. Lipopolysaccharide (LPS) has been used as the agonist in construction of mastitis models in vivo and in vitro [7, 8]. Recent studies indicated that in addition to LPS, saturated fatty acids (SFA) could also activate Toll-like-receptor (TLR) 4 signaling pathway through regulation of receptor dimerization and recruitment into lipid rafts in a reactive oxygen species (ROS)-dependent manner [9]. Further studies revealed that the cooperative effect of SFA and LPS on monocytes resulted in about 3-fold higher mRNA and protein expression of pro-inflammatory cytokines than the sum of individual responses to SFA and LPS, indicating nutrient modification of TLR4–mediated inflammation [10]. It was reported that SFA were enriched in milk of mice fed western diet, and triggered ceramide accumulation and inflammation in the neonates [11]. Notably, the neonatal toxicity requires TLR but not microbiota [11], suggesting that SFA may induce inflammatory responses independent of exogenous pathogens. Studies in vivo and in vitro have demonstrated that n-3 polyunsaturated fatty acids (PUFA) could block SFA- and/or LPS-induced TLR signalling and attenuate inflammation [12]. However, little is known about whether the mammary inflammation induced by nutrients such as SFA and pathogens such as LPS could be attenuated by consumption of diets rich in n-3 PUFA.

                              Therefore, the objectives of the present study were to evaluate the interactive effect of diets and reproductive stages on fatty acids (FA) metabolism and inflammation as well as to determine the effect of dietary n-3 PUFA on plasma FA composition and mammary glands inflammation.

                              Results

                              Effect of diet type on plasma FA composition at different reproductive stages

                              Consumption of the SO diet increased plasma concentrations of C20:4n6 and total n-6 PUFA at day 3 postpartum (Table 1). In contrast, consumption of the FO diet increased plasma concentrations of C20:5n3 from day 14 of gestation and C22:6n3 at day 3 postpartum. Compared with the SO-fed rats, the FO-fed rats had lower plasma concentration of C16:0 at day 0 of gestation and day 3 postpartum, concentrations of C18:2n6, C20:4n6 and total n-6 PUFA at day 14 of gestation and day 3 postpartum, and concentrations of C18:0 and total SFA at the three time points evaluated, but had higher plasma concentration of C22:6n3 at day 3 postpartum, and concentrations of C20:5n3 and total n-3 PUFA at day 14 of gestation and day 3 postpartum.
                              Table 1

                              Plasma FA composition (μg/mL) of rats fed different diets at different reproductive stages 1

                              Item

                              Group

                              Day 0 of gestation

                              Day 14 of gestation

                              Day 3 postpartum

                              Pooled SEM

                              C14:0

                              SO

                              30.69a

                              28.54ab

                              32.62a

                              13.69

                              FO

                              14.35b

                              18.22ab

                              21.11ab

                               

                              C16:0

                              SO

                              822.89a

                              738.64ab

                              948.69a

                              249.21

                              FO

                              432.50c

                              455.61bc

                              373.53c

                               

                              C18:0

                              SO

                              588.93a

                              526.74a

                              688.14a

                              152.56

                              FO

                              342.09b

                              311.58b

                              239.47b

                               

                              C20:0

                              SO

                              21.42a

                              10.30b

                              13.32ab

                              8.91

                              FO

                              6.33b

                              6.71b

                              4.17b

                               

                              SFA

                              SO

                              1463.92a

                              1304.23a

                              1682.78a

                              412.54

                              FO

                              795.28b

                              792.12b

                              638.28b

                               

                              C16:1

                              SO

                              59.10a

                              47.62ab

                              57.58a

                              23.81

                              FO

                              42.06ab

                              42.55ab

                              20.74b

                               

                              C18:1n7

                              SO

                              27.86ab

                              23.04b

                              42.41a

                              14.47

                              FO

                              23.01b

                              20.98b

                              22.75b

                               

                              C18:1n9

                              SO

                              191.83

                              177.43

                              156.96

                              40.63

                              FO

                              198.23

                              203.30

                              162.35

                               

                              C20:1

                              SO

                              30.67ab

                              26.84abc

                              40.99a

                              15.54

                              FO

                              10.95cd

                              12.91bcd

                              5.41d

                               

                              MUFA

                              SO

                              309.46

                              274.93

                              297.94

                              86.48

                              FO

                              274.25

                              279.74

                              211.26

                               

                              C18:3n3

                              SO

                              8.99abc

                              10.82ab

                              11.65a

                              1.84

                              FO

                              7.07bc

                              8.42abc

                              6.43c

                               

                              C20:5n3

                              SO

                              7.59b

                              5.32b

                              8.00b

                              22.64

                              FO

                              26.62b

                              87.73a

                              95.75a

                               

                              C22:6n3

                              SO

                              40.45b

                              37.53b

                              76.60b

                              36.39

                              FO

                              73.89b

                              63.54b

                              146.34a

                               

                              n-3 PUFA

                              SO

                              64.84c

                              54.74c

                              96.25c

                              50.47

                              FO

                              107.58bc

                              159.69b

                              248.51a

                               

                              C18:2n6

                              SO

                              253.41a

                              230.13a

                              262.59a

                              45.26

                              FO

                              235.76a

                              163.29b

                              169.54b

                               

                              C20:4n6

                              SO

                              257.71b

                              233.28b

                              400.24a

                              87.69

                              FO

                              246.19b

                              116.03c

                              197.67bc

                               

                              n-6 PUFA

                              SO

                              511.12b

                              463.41bc

                              662.83a

                              119.17

                              FO

                              481.95bc

                              279.31d

                              367.21cd

                               

                              TFA

                              SO

                              2349.34ab

                              2097.31abc

                              2739.80a

                              557.06

                              FO

                              1704.65bc

                              1510.87c

                              1465.26c

                               

                              1 Values of a certain fatty acid assigned no common superscript letter differ significantly (P < 0.05).

                              Effect of reproductive stages and diet type on plasma FFA concentration and inflammation mediators in rat mammary glands

                              Plasma FFA concentration in both groups was higher at day 3 postpartum than at day 0 and 14 of gestation, with no difference observed between groups at each of the time points evaluated (Figure 1). In both groups, the mRNA abundances of IL-8 and xanthine oxidoreductase (XOR) (Figure 2), the protein levels of IL-1β (Figure 3) and TNF-α (Figure 4) as well as PMN prevalence (Figure 5) were higher at day 14 of gestation than at day 0 of gestation. Compared with the SO-fed rats, the FO-fed rats had lower mammary mRNA abundance of XOR (Figure 2) and protein level of TNF-α (Figure 4), but had higher mammary mRNA abundances of IL-10 and peroxisome proliferator-activated receptor (PPAR)-γ at day 14 of gestation (Figure 2).
                              http://static-content.springer.com/image/art%3A10.1186%2F1476-511X-12-190/MediaObjects/12944_2013_Article_1015_Fig1_HTML.jpg
                              Figure 1

                              Plasma FFA concentration of rats fed different diets at different reproductive stages. Plasma FFA concentration was determined by ELISA using plasma collected from rats fed the SO or FO diet at day 0 of gestation, day 14 of gestation and day 3 postpartum. Statistics are shown as means ± SE. Statistics with no common letters differ significantly (P < 0.05).

                              http://static-content.springer.com/image/art%3A10.1186%2F1476-511X-12-190/MediaObjects/12944_2013_Article_1015_Fig2_HTML.jpg
                              Figure 2

                              Relative mRNA abundances of rats fed different diets at different reproductive stages. mRNA abundances of IL-8 (A), XOR (B), IL-10 (C) and PPAR-γ (D) was determined by RT-PCR with mammary tissues collected from rats fed the SO or FO diet at day 0 and 14 of gestation. Statistics are shown as means ± SE. Statistics with no common letters differ significantly (P < 0.05).

                              http://static-content.springer.com/image/art%3A10.1186%2F1476-511X-12-190/MediaObjects/12944_2013_Article_1015_Fig3_HTML.jpg
                              Figure 3

                              Immunohistochemical localization of IL-1β in udder of rats fed different diets at different reproductive stages. The microphotograph from one rat with the positive primary IL-1β antibody was visualized with DAB reaction. The area positive for IL-1β in mammary tissues of rats fed the SO diet (B) or FO diet (C) at day 0 and 14 of gestation was quantified by Easy Image 3000 software. IL-1β production is presented as the average percentage of the positively stained areas (A). Statistics are shown as means ± SE. Statistics with no common letters differ significantly (P < 0.05).

                              http://static-content.springer.com/image/art%3A10.1186%2F1476-511X-12-190/MediaObjects/12944_2013_Article_1015_Fig4_HTML.jpg
                              Figure 4

                              Immunohistochemical localization of TNF-α in udder of rats fed different diets at different reproductive stages. The microphotograph from one rat with the positive primary TNF-α antibody was visualized with DAB reaction. The area positive for TNF-α in mammary tissues of rats fed the SO diet (B) or FO diet (C) at day 0 and14 of gestation was quantified by Easy Image 3000 software. TNF-α production is presented as the average percentage of the positively stained areas (A). Statistics are shown as means ± SE. Statistics with no common letters differ significantly (P < 0.05).

                              http://static-content.springer.com/image/art%3A10.1186%2F1476-511X-12-190/MediaObjects/12944_2013_Article_1015_Fig5_HTML.jpg
                              Figure 5

                              Histopathology of mammary glands of rats fed different diets at different reproductive stages. Hematoxylin and eosin stained slides were made with mammary tissues collected from rats fed the SO diet (B) or FO diet (C) at day 0 and 14 of gestation. PMN prevalence (A) in alveoli was estimated by using light microscopic (Olympus BH2, Japan) analysis at a magnification of 400×. Statistics are shown as means ± SE. Statistics with no common letters differ significantly (P < 0.05).

                              Effect of LPS infusion and diet type on plasma FFA concentration and plasma FA composition

                              Following LPS infusion at day 3 postpartum, both groups had increased plasma FFA concentration with no difference observed between them (Figure 6). LPS infusion resulted in increased plasma concentrations of C18:1n9, C18:3n3, C18:2n6 and total n-6 PUFA in the SO-fed rats, whereas no change was observed in the FO-fed rats. As a result, the FO-fed rats still had higher plasma concentrations of C20:5n3, C22:6n3 and total n-3 PUFA, and lower plasma concentrations of C18:2n6, C20:4n6, total n-6 PUFA, SFA and FA than the SO-fed rats following LPS infusion (Table 2).
                              http://static-content.springer.com/image/art%3A10.1186%2F1476-511X-12-190/MediaObjects/12944_2013_Article_1015_Fig6_HTML.jpg
                              Figure 6

                              Plasma FFA concentration of rats fed different diets and challenged with different stimulus. Plasma FFA concentration was determined by ELISA using plasma collected from rats fed the SO or FO diet and challenged with saline or LPS. Statistics are shown as means ± SE. Statistics with no common letters differ significantly (P < 0.05).

                              Table 2

                              Plasma FA composition (μg/mL) of rats fed different diets and challenged with different stimulus

                              Item1

                              SS

                              SL

                              FS

                              FL

                              Pooled SEM

                              C14:0

                              32.62ab

                              45.60a

                              21.11b

                              20.19b

                              13.95

                              C16:0

                              948.69a

                              1103.10a

                              373.53b

                              581.32b

                              231.72

                              C18:0

                              688.14a

                              791.68a

                              239.47b

                              401.64b

                              138.39

                              C20:0

                              13.32ab

                              17.10a

                              4.17c

                              8.11bc

                              4.04

                              SFA

                              1682.78a

                              1957.48a

                              634.11b

                              1003.14b

                              382.43

                              C16:1

                              57.58ab

                              80.16a

                              20.74c

                              43.88bc

                              23.12

                              C18:1n7

                              42.41ab

                              51.73a

                              22.75b

                              21.87b

                              19.09

                              C18:1n9

                              156.96b

                              218.23a

                              162.35b

                              195.47ab

                              36.77

                              C20:1

                              40.99ab

                              55.48a

                              5.41c

                              21.85bc

                              18.35

                              MUFA

                              297.94ab

                              405.60a

                              211.26b

                              283.07ab

                              86.41

                              C18:3n3

                              11.65b

                              21.24a

                              6.43b

                              8.32b

                              4.67

                              C20:5n3

                              8.00b

                              11.32b

                              95.75a

                              142.18a

                              41.03

                              C22:6n3

                              76.60c

                              96.50bc

                              146.34ab

                              161.66a

                              32.93

                              n-3PUFA

                              96.25b

                              129.05b

                              248.51a

                              312.16a

                              59.83

                              C18:2n6

                              262.59b

                              379.98a

                              169.54c

                              202.36bc

                              53.52

                              C20:4n6

                              400.24a

                              485.86a

                              197.67b

                              206.75b

                              79.46

                              n-6PUFA

                              662.83b

                              865.84a

                              367.21c

                              409.11c

                              117.17

                              TFA

                              2739.80ab

                              3357.97a

                              1465.26c

                              2015.59bc

                              519.16

                              abcValues in the same row assigned no common superscript letter differ significantly (P < 0.05).

                              1SS, rats fed the SO diet and infused by saline; SL, rats fed the SO diet and infused by LPS; FS, rats fed the FO diet and infused by saline; FL, rats fed the FO diet and infused by LPS.

                              Effect of diet type on inflammation mediators in LPS-infused mammary glands

                              Mammary mRNA abundances of IL-1β, TNF-α and XOR (Figure 7) as well as PMN prevalence (Figure 8) were increased following LPS infusion at day 3 postpartum, which was observed in the SO-fed rats rather than in the FO-fed rats. Accordingly, mammary mRNA abundances of IL-1β, TNF-α and XOR following LPS infusion was lower in the FO-fed than in the SO-fed rats (Figure 7). In contrast, mammary IL-10 mRNA abundance was higher in the FO-fed than in the SO-fed rats, although it was decreased in the FO-fed rats following LPS challenge (Figure 7).
                              http://static-content.springer.com/image/art%3A10.1186%2F1476-511X-12-190/MediaObjects/12944_2013_Article_1015_Fig7_HTML.jpg
                              Figure 7

                              Relative mRNA abundances of rats fed different diets and challenged with different stimulus. mRNA abundances of IL-1β (A), TNF-α (B), XOR (C), IL-10 (D) and PPAR-γ (E) was determined by RT-PCR with mammary tissues collected from rats fed the SO or FO diet and challenged with saline or LPS. Statistics are shown as means ± SE. Statistics with no common letters differ significantly (P < 0.05).

                              http://static-content.springer.com/image/art%3A10.1186%2F1476-511X-12-190/MediaObjects/12944_2013_Article_1015_Fig8_HTML.jpg
                              Figure 8

                              Histopathology of mammary glands of rats fed different diets and challenged with different stimulus. Hematoxylin and eosin stained slides were made with mammary tissues collected from rats fed the SO diet (B) or FO diet (C) and challenged with saline or LPS. PMN prevalence (A) in alveoli was estimated by using light microscopic (Olympus BH2, Japan) analysis at a magnification of 400×. Statistics are shown as means ± SE. Statistics with no common letters differ significantly (P < 0.05).

                              Discussion

                              The beneficial effects of FO have been documented abundantly [1315]. And evidences concerning n-3 PUFA alleviating inflammation were persuasive [1618]. However, the effect of dietary FO on attenuating mammary inflammation has not been verified. Thus, the present study was focused on the mammary glands to test the anti-inflammatory effect of dietary FO.

                              Given that inflammatory responses are in strong association with FA types such as n-6 and n-3 PUFA, we firstly examined the plasma FA profile at different reproductive stages of rats receiving different diets. An amplified plasma concentration of n-3 PUFA was observed following FO consumption for 14 days in this study, which agreed well with the previous study in horses by Hall et al[19]. Hall et al[19] also found decreased plasma n-6 FA concentration in the FO-fed horses, but little variation of plasma n-6 PUFA concentration was observed in the FO-fed rats in this study. Noting that the horses used in the study of Hall et al[19] consumed FO for 6 weeks, a shorter consumption period (24 days) in this study may explain the little variation of n-6 PUFA. In addition, it was verified in the present study that substituting SO with FO resulted in higher plasma n-3 PUFA concentration and lower concentrations of SFA and n-6 PUFA. Amira et al[20] reported that decreased n-6/n-3 ratio led to higher plasma n-3 PUFA concentration and lower n-6 PUFA concentration, which was consistent with our results considering that the n-6/n-3 ratio in our experimental diets was approximately 0.5:1 in the FO diet and 10:1 in the SO diet.

                              Another result in the present study was that up-regulated plasma FFA emerged with the advance of gestation. As FFA have been reported to be associated with inflammation including mastitis [20, 21], we further studied whether the advance of gestation was related to the expression of inflammation mediators. In both diet groups, the mRNA abundances of XOR and IL-8, protein levels of IL-1β and TNF-α as well as PMN prevalence all increased from day 0 of gestation to day 14 of gestation. TNF-α, IL-8 and IL-1β are all known as pro-inflammatory cytokines. Stimulated by a range of agents, TNF-α induces other inflammatory mediators that participated in inflammatory responses [22]. IL-8 can activate neutrophils to degranulate and induce tissue damage [23]. Moreover, IL-1β and TNF-α were elucidated to be key mediators participating in the neutrophil recruitment into the udder [24]. XOR is also an inflammatory indicator that highly expressed in mammary tissues during pregnancy and lactation [25, 26]. Hence, we proposed that the advance of pregnancy was accompanied by inflammatory responses of the udder. Notably, compared with the SO-fed rats, the FO-fed rats had lower mRNA levels of XOR and TNF-α but higher mRNA levels of IL-10 and PPAR-γ, both of which are acknowledged as anti-inflammatory mediators [27, 28]. The down-regulation of XOR and TNF-α may be induced by the lower SFA and n-6 PUFA concentrations and higher n-3 PUFA concentrations in plasma. Consistent with this notion, it has been shown that the decreased production of TNF was accompanied by a decreased ratio of C20:4n6 to C20:5n3 in the membrane phospholipids of mononuclear cells, which indicates the significance of systemic n-6/n-3 PUFA profile in inflammatory responses [29].

                              Excited by the potential effect of FO in decreasing pro-inflammatory cytokines in mammary glands, we further determined the anti-inflammatory effect of FO with a rat mastitis model. Rats at day 3 postpartum were infused with LPS or saline. LPS challenge resulted in elevated plasma FFA in both groups indicating the systemic inflammation induced by LPS. However, only in the SO-fed rats did LPS infusion stimulate the expression of IL-1β, XOR and TNF-α. During the process of mammary glands inflammation induced by advance of gestation as well as by LPS infusion, the relatively lower level of mammary pro-inflammatory mediators in the FO-fed rats may result from higher total n-3 PUFA concentration and lower SFA concentration in plasma. During lactation, the mammary blood flow increased sharply [30] and the mammary glands may become more susceptible to substances in the blood. Therefore, we assumed that the relatively higher SFA concentration in the SO-fed rats may lead to aggravated toxicity of LPS. On one hand, LPS could activate the TLR4 pathway, free NF-κB [31] and finally facilitate the expression of pro-inflammatory cytokines in the mammary glands of the SO-fed rats. On the other hand, the elevated XOR expression may enhance the generation of ROS which may participate in the TLR4 dimerization and recruitment of TLR4 into lipid rafts on condition that SFA were metabolized into ceramide [9, 10]. The higher levels of PPAR-γ and IL-10 in the FO-fed rats may block the TLR4 pathway, as elucidated previously [32, 33]. It has been demonstrated that DHA specifically enhanced anti-inflammatory IL-10 secretion [34]. Moreover, it has been shown in HK-2 cells that DHA and EPA can activate the mRNA expression of PPAR-γ [35]. Meanwhile, n-3 PUFA and their metabolites are natural ligands for PPAR-γ [36] and DHA for example can be metabolized by oxygenase to 17-OH and 7-OH-DHA thus facilitates PPAR-γ activation [37]. Therefore, n-3 PUFA can upregulate PPAR-γ expression and promote PPAR-γ functioning. Noticeably, maternal PPAR-γ was demonstrated to be pivotal for protecting the nursing newborns by suppressing the production of inflammatory lipids in the lactating mammary glands [38]. Additionally, it was assumed that IL-10 may inhibit the production of TNF-α and IL-6 in the mammary glands [39]. Therefore, we postulated that FO might down-regulate the mRNA expression of IL-1β, XOR and TNF-α through enhancing the expression of IL-10 and PPAR-γ.

                              Conclusions

                              This study suggested that mammary inflammation induced by pregnancy proceeding and pathogen challenge might be attenuated by consumption of FO rich in n-3 PUFA. IL-10 and PPAR-γ appeared to be the key mediators elicited by FO consumption in ameliorating the mammary inflammation.

                              Methods

                              Animals, diets and treatments

                              All experimental protocols were approved by the Animal Care and Use Committee of Sichuan Agricultural University, and were in accordance with the National Research Council’s Guide for the Care and Use of Laboratory Animals. The experimental rats (Virgin female Sprague-Dawley rats) were purchased from Sichuan Academy of Medical Sciences-Sichuan Provincial People’s Hospital Experimental Animal Research Institute, and housed individually in metallic cages in a temperature controlled (22 ± 2°C) room with a 12 h light/dark cycle and relative humidity was maintained at 60 ± 10%.

                              Experimental diets (Table 3) were formulated to meet or exceed the nutrient requirements of gestating and lactating rats as recommended by AIN-93G. To create difference in inclusion levels of dietary SFA and n-3 PUFA and to make sure the two diets were isocaloric, the 7 kg fat included in the experimental diets was composed of 7 kg soybean oil (SO) in the SO diet, and 5 kg fish oil (FO), 1 kg lard and 1 kg SO in the FO diet. The FA composition of the two types of oil and experimental diets is shown in Table 4. To avoid PUFA oxidation, all diets were stored at -20 C.
                              Table 3

                              Ingredients and composition of experimental diets (air-dry basis)

                              Ingredients

                              Content (%)

                              Composition

                              Content (%)

                              Corn starch

                              39.75

                              Crude protein

                              16.23

                              Casein

                              20

                              ME, Mcal/kg

                              3.81

                              Gelatinization starch

                              13.2

                              Lysine

                              1.53

                              Sucrose

                              10

                              Methionine

                              0.57

                              Fat1

                              7

                              Calcium

                              0.50

                              Fiber

                              5

                              Available phosphorus

                              0.16

                              Mineral premix2

                              3.5

                                

                              Vitamin premix3

                              1

                                

                              L-cysteine

                              0.3

                                

                              Choline Chloride

                              0.25

                                

                              Total

                              100

                                

                              1The 7 kg fat was composed of 7 kg SO in the SO diet, and 5 kg FO, 1 kg lard and 1 kg SO in the FO diet.

                              2Provided per kg of diet: Calcium 5000 mg, Phosphorus 1561 mg, Potassium 3600 mg, sodium 1019 mg, Chlorine 1517 mg, magnesium 510 mg, Rion35 mg, Zinc 30 mg, Manganese 10 mg, Copper 6 mg, Selenium 0.15 mg, Iodine 0.2 mg.

                              3Provided per kg of diet: Vitamin A 4 000 IU, Vitamin D3 1000 IU, Vitamin K3 0.75 mg, Vitamin B1 6.0 mg, Vitamin B2 7.0 mg, Vitamin B6 6.0 mg, Vitamin B12 0.02 mg, nicotinic acid 30.0 mg, D-calcium pantothenate 15.3 mg, folic acid 2.0 mg, biotin 0.2 mg.

                              Table 4

                              FA composition of oil (g/100 g) and diets (g/kg) (as fed basis)

                              Fatty acids

                              SO

                              FO

                              SO diet

                              FO diet

                              C14:0

                              0.05

                              0.92

                              0.09

                              0.39

                              C16:0

                              10.93

                              9.05

                              5.25

                              5.49

                              C18:0

                              2.25

                              1.60

                              2.03

                              2.05

                              C20:0

                              0.02

                              0.12

                              0.20

                              0.07

                              C16:1

                              0.09

                              6.14

                              0.06

                              2.00

                              C18:1

                              27.43

                              23.00

                              11.72

                              10.77

                              C20:1

                              0.03

                              3.06

                              0.22

                              1.04

                              C22:1

                              ND1

                              2.31

                              0.23

                              0.78

                              C18:2n6

                              52.00

                              2.27

                              22.54

                              4.67

                              C18:3n3

                              5.80

                              1.49

                              2.18

                              0.68

                              C20:5n3

                              ND

                              21.90

                              0.225

                              4.48

                              C22:6n3

                              ND

                              14.60

                              ND

                              2.84

                              Other

                              1.40

                              13.54

                              0.26

                              2.76

                              ∑FA 2

                              100

                              100

                              45

                              38

                              ∑SFA 3

                              13.25

                              11.69

                              7.57

                              8.00

                              ∑MUFA 4

                              27.55

                              34.51

                              12.23

                              14.58

                              ∑PUFA 5

                              57.80

                              40.26

                              24.94

                              12.66

                              ∑SFA/∑FA

                              13.25

                              11.69

                              16.82

                              21.05

                              ∑MUFA/∑FA

                              27.55

                              34.51

                              27.18

                              38.37

                              ∑PUFA/∑FA

                              57.80

                              40.26

                              55.43

                              33.32

                              ∑n-3 6

                              5.8

                              37.99

                              2.41

                              7.99

                              ∑n-6 7

                              52

                              2.27

                              22.54

                              4.67

                              ∑n-6/∑n-3

                              8.97

                              0.06

                              9.36

                              0.58

                              1ND, Not detected.

                              2∑FA means the sum of content of all fatty acids evaluated.

                              3∑SFA means the sum of C14:0, C16:0, C18:0 and C20:0 content.

                              4∑MUFA means the sum of C16:1, C18:1, C20:1 and C22:1 content.

                              5∑PUFA means the sum of C18:2n6, C18:3n3, C20:5n3 and C22:6n3 content.

                              6∑n-3 means the sum of C18:3n3, C20:5n3 and C22:6n3 content.

                              7∑n-6 means the content of C18:2n6.

                              At the beginning of the experiment, all female rats were housed together with male rats to complete mating. When seminal plug in the vagina was detected in the morning, then that day was designated as day 0 of gestation. Forty-eight rats after mating were housed individually and began to receive the SO or FO diets. Blood and mammary tissue samples (n = 6) at day 0 and 14 of gestation and day 3 postpartum, respectively, were collected 9 hours after intramammary infusion of LPS according to the work of Miao et al[40]. The infusion was conducted according to the methods of Zhong et al[41]. Briefly, the inguinal mammary glands of rats were infused with 0 or 10 μg E.coli LPS (O55:B5, Sigma, USA) dissolved in 100 μl sterile, pyrogen-free, physiological saline. Blood samples were collected (after 12-h fast and following isoflurane anesthesia) through intra-orbital bleeding for the separation of plasma and then stored at -20°C until analysis. The fourth mammary glands were cut with scissors, and then the left and right mammary glands were snap frozen in lipid nitrogen and stored at -80°C or fixed in 4% paraformaldehyde and stored at 4°C respectively.

                              FA composition analysis

                              Plasma FA composition was determined according to the methods described by Fernández-Real et al[42] with modification. In brief, 30-50 mg weighed plasma sample was mixed with four milliliter acetyl chloride and methanol solution (1:10, vol/vol). Transesterification was conducted and the pooled solvent extracts were dried by nitrogen at room temperature. The residues were dissolved in 5 ml hexane with internal standard and subjected to water bath at 80°C for 2 hours. Then 7% potassium carbonate was added, and supernatant was collected for analysis. Hewlett-Packard 6890 gas chromatograph equipped with a flame ionization detector was used to analyze the FA composition, and helium was used as carrier gas. The injector temperature was programmed at 250°C and the detector temperature was 270°C.

                              FFA analysis

                              A commercial ELISA kit (GBD, USA) was used to determine plasma free fatty acids (FFA) concentration as described by the manufacturer’s protocols. All assays were conducted in 96-well plates and absorbance at 450 nm was detected with a microplate reader. FFA values were calculated according to the standard curve generated from the corresponding absorbance of the standard reagent.

                              RNA extraction and real-time PCR

                              The mRNA abundances of the mammary gland samples were measured by real-time polymerase chain reaction (PCR) as previously described [43]. Total RNA was extracted using a TRIZOL Reagent kit (Invitrogen, Carlsbad, CA). The cDNA was prepared using a reverse transcription (RT) kit (TAKARA, Japan) following the manufacture’s instruction. Primers were synthesized by Chengdu Tiantai Biological Company (Chengdu, China). Beta-actin was used as an internal control according to the work of Gu et al [43]. The nucleotide primer sequences are listed in Table 5. Quantitative real-time RT-PCR analysis was performed using a 7900 real-time PCR system (Applied Biosystems, USA) and SYBR Green assays (Master Mix SYBR® Green TAKARA, Japan). The specificity of PCR products were examined with melting curve analysis. Results (fold changes) were expressed as 2-ΔΔCt with ΔΔCt = (Ct ij - Ct β-actin j) - (Ct i1 - Ct β-actin1), where Ct ij and Ct β-actin j are the Ct for gene i and for β-actin in a sample (named j), and where Ct i1 and Ct β-actin1 are the Ct in sample 1, expressed as the standard.
                              Table 5

                              PCR product sequences of oligonucleotide primers used to amplify cytokines and a house keeping gene

                              Gene

                               

                              Primer sequences(5′-3′)

                              Products size

                              Genebank accession number

                              IL-1β

                              Forward

                              tgacctgttctttgaggctgac

                              113 bp

                              M98820.1

                               

                              Reverse

                              cgagatgctgctgtgagatttg

                                

                              TNF-α

                              Forward

                              ccactctgacccctttactctga

                              154 bp

                              NM_013693.2

                               

                              Reverse

                              ctgtcccagcatcttgtgtttc

                                

                              IL-8

                              Forward

                              ccagcaggaaaccagaagaaag

                              123 bp

                              NM_001173399.2

                               

                              Reverse

                              caactttgtcacgaccataccc

                                

                              IL-10

                              Forward

                              gctggacaacatactgctgaca

                              112 bp

                              NM_012854.2

                               

                              Reverse

                              ctggggcatcacttctaccag

                                

                              PPAR-γ

                              Forward

                              gccctttggtgactttatggag

                              170 bp

                              NM_013124.3

                               

                              Reverse

                              gcagcaggttgtcttggatgt

                                

                              XOR

                              Forward

                              gattctcacacacctcctgacg

                              156 bp

                              NM_011723.2

                               

                              Reverse

                              ccccacacacacacacacactat

                                

                              β-actin

                              Forward

                              ctgtgtggattggtggctctatc

                              133 bp

                              NM_031144.2

                               

                              Reverse

                              gctcagtaacagtccgcctagaa

                                

                              Histopathologic examination

                              Mammary tissue samples fixed in 4% paraformaldehyde for 24 h were further processed with standard dehydration and paraffin-wax embedding procedures to produce tissue blocks. Hematoxylin and eosin stained slides were made as described previously [40]. The prevalence of polymorphonuclear neutrophils (PMN) in alveoli was estimated by using light microscopic (Olympus BH2, Japan) analyses at a magnification of 400× as previously described [40]. Briefly, four sections of mammary tissues were chosen for each rat. Ten fields were randomly selected per sample. Results were presented as average PMN infiltration scores for each time point.

                              Immunohistochemistry

                              Polyclonal antibodies combined with the avidin-biotinperoxidase complex (ABC) technique were used for the immunohistochemical detection of interleukin (IL)-1β (Abnova, USA) and tumor necrosis factor (TNF)-α (Novus, USA). All samples from one animal were analyzed within the same assay run, and within each assay run treatment animals to be compared were included. The quantification of IL-1β and TNF-α protein expression in mammary tissue samples was performed as described [44]. For each sample, a relative value of the amount of cytokine produced was expressed as the average percentage of the positively stained areas.

                              Statistic analysis

                              All statistical evaluation was performed by using the General Linear Model procedures of SAS statistical package (V8.1, SAS Institute Inc., Cary, NC). The statistic model used is as follows: Y ijk  = μ + A i  + B j  + (A × B) ij  + ϵ ijk , where Y is the analysed variable, μ the overall mean, A the effect of diet, B the effect of time or LPS, A × B the effect of diet × time or LPS interaction, and ϵ the random error. Least-squares means comparison was used to evaluate differences among treatments. P values ≤ 0.05 were considered statistical significance.

                              Declarations

                              Acknowledgments

                              The work was supported by the National Natural Science Fundation of China (30901042), Sichuan Province Science Foundation for Fostering Youths Talents (2011JQ0015), Key Program Fundation of the Education Department of Sichuan Province, and Novus Research Fellowship (NRF).

                              Authors’ Affiliations

                              (1)
                              Key Laboratory for Animal Disease Resistance Nutrition of the Ministry of Education of China, Animal Nutrition Institute, Sichuan Agricultural University

                              References

                              1. Santman-Berends IM, Olde Riekerink RG, Sampimon OC, van Schaik G, Lam TJ: Incidence of subclinical mastitis in Dutch dairy heifers in the first 100 days in lactation and associated risk factors. J Dairy Sci. 2012, 95: 2476-2484. 10.3168/jds.2011-4766View ArticlePubMed
                              2. Akers RM, Nickerson SC: Mastitis and its impact on structure and function in the ruminant mammary gland. J Mammary Gland Biol Neoplasia. 2011, 16: 275-289. 10.1007/s10911-011-9231-3View ArticlePubMed
                              3. Gerjets I, Traulsen I, Reiners K, Kemper N: Assessing individual sow risk factors for coliform mastitis: a case–control study. Prev Vet Med. 2011, 100: 248-251. 10.1016/j.prevetmed.2011.04.012View ArticlePubMed
                              4. Sordillo LM: New concepts in the causes and control of mastitis. J Mammary Gland Biol Neoplasia. 2011, 16: 271-273. 10.1007/s10911-011-9239-8View ArticlePubMed
                              5. Deluyker HA, Van Oye SN, Boucher JF: Factors affecting cure and somatic cell count after pirlimycin treatment of subclinical mastitis in lactating cows. J Dairy Sci. 2005, 88: 604-614. 10.3168/jds.S0022-0302(05)72724-7View ArticlePubMed
                              6. Gerjets I, Kemper N: Coliform mastitis in sows: a review. J Swine Health Prod. 2009, 17: 97-105.
                              7. Porcherie A, Cunha P, Trotereau A, Roussel P, Gilbert FB, Rainard P, Germon P: Repertoire of Escherichia coli agonists sensed by innate immunity receptors of the bovine udder and mammary epithelial cells. Vet Res. 2012, 43: 14- 10.1186/1297-9716-43-14PubMed CentralView ArticlePubMed
                              8. Chen H, Mo X, Yu J, Huang Z: Alpinetin attenuates inflammatory responses by interfering toll-like receptor 4/nuclear factor kappa B signaling pathway in lipopolysaccharide-induced mastitis in mice. Int Immunopharmacol. 2013, 17: 26-32. 10.1016/j.intimp.2013.04.030View ArticlePubMed
                              9. Wong SW, Kwon MJ, Choi AMK, Kim HP, Nakahira K, Hwang DH: Fatty acids modulate toll-like receptor 4 activation through regulation of receptor dimerization and recruitment into lipid rafts in a reactive oxygen species-dependent manner. J Biol Chem. 2009, 284: 27384-27392. 10.1074/jbc.M109.044065PubMed CentralView ArticlePubMed
                              10. Schwartz EA, Zhang WY, Karnik SK, Borwege S, Anand VR, Laine PS, Su Y, Reaven PD: Nutrient modification of the innate immune response: a novel mechanism by which saturated fatty acids greatly amplify monocyte inflammation. Arterioscler Thromb Vasc Biol. 2010, 30: 802-808. 10.1161/ATVBAHA.109.201681View ArticlePubMed
                              11. Du Y, Yang M, Lee S, Behrendt CL, Hooper LV, Saghatelian A, Wan Y: Maternal western diet causes inflammatory milk and TLR2/4-dependent neonatal toxicity. Genes Dev. 2012, 26: 1306-1311. 10.1101/gad.191031.112PubMed CentralView ArticlePubMed
                              12. Liu Y, Chen F, Odle J, Lin X, Zhu H, Shi H, Hou Y, Yin J: Fish oil increases muscle protein mass and modulates Akt/FOXO, TLR4, and NOD signaling in weanling piglets after lipopolysaccharide challenge. J Nutr. 2013, 143: 1331-1339. 10.3945/jn.113.176255View ArticlePubMed
                              13. Kris-Etherton PM: Fish consumption, fish oil, omega-3 fatty acids, and cardiovascular disease. Circulation. 2002, 106: 2747-2757. 10.1161/01.CIR.0000038493.65177.94View ArticlePubMed
                              14. Wang C, Harris WS, Chung M, Lichtenstein AH, Balk EM, Kupelnick B, Jordan HS, Lau J: n-3 Fatty acids from fish or fish-oil supplements, but not alpha-linolenic acid, benefit cardiovascular disease outcomes in primary- and secondary-prevention studies: a systematic review. Am J Clin Nutr. 2006, 84: 5-17.PubMed
                              15. Herold PM, Kinsella JE: Fish oil consumption and decreased risk of cardiovascular disease: a comparison of findings from animal and human feeding trials. Am J Clin Nutr. 1986, 43: 566-598.PubMed
                              16. Lo C-J, Chiu KC, Fu M, Lo R, Helton S: Fish oil decreases macrophage tumor necrosis factor gene transcription by altering the NFκB activity. J Surg Res. 1999, 82: 216-221. 10.1006/jsre.1998.5524View ArticlePubMed
                              17. Novak TE, Babcock TA, Jho DH, Helton WS, Espat NJ: NF-κB inhibition by ω-3 fatty acids modulates LPS-stimulated macrophage TNF-α transcription. Am J Physiol Lung Cell Mol Physiol. 2003, 284: L84-L89.View ArticlePubMed
                              18. Khalfoun B, Thibault F, Watier H, Bardos P, Lebranchu Y: Docosahexaenoic and eicosapentaenoic acids inhibit in vitro human endothelial cell production of interleukin-6. Adv Exp Med Biol. 1996, 400: 589-597.
                              19. Hall JA, Saun RJ, Wander RC: Dietary (n-3) fatty acids from menhaden fish oil alter plasma fatty acids and leukotriene B synthesis in healthy horses. J Vet Intern Med. 2004, 18: 871-879. 10.1111/j.1939-1676.2004.tb02635.xView ArticlePubMed
                              20. Amira A, Zuki A, Goh Y, Noordin M, Ebrahimi M: Effects of varying levels of n-6: n-3 fatty acid ratio on plasma fatty acid composition and prostanoid synthesis in pregnant rats. Afr J Biotechnol. 2010, 9: 8881-8888.
                              21. Hunt KM, Williams JE, Shafii B, Hunt MK, Behre R, Ting R, McGuire MK, McGuire MA: Mastitis is associated with increased free fatty acids, somatic cell count, and interleukin-8 concentrations in human milk. Breastfeed Med. 2013, 8: 105-110. 10.1089/bfm.2011.0141PubMed CentralView ArticlePubMed
                              22. Aggarwal BB, Shishodia S, Sandur SK, Pandey MK, Sethi G: Inflammation and cancer: how hot is the link?. Biochem Pharmacol. 2006, 72: 1605-1621. 10.1016/j.bcp.2006.06.029View ArticlePubMed
                              23. Dinarello CA: Proinflammatory cytokines. Chest. 2000, 118: 503-508. 10.1378/chest.118.2.503View ArticlePubMed
                              24. Oviedo-Boyso J, Valdez-Alarcón JJ, Cajero-Juárez M, Ochoa-Zarzosa A, López-Meza JE, Bravo-Patino A, Baizabal-Aguirre VM: Innate immune response of bovine mammary gland to pathogenic bacteria responsible for mastitis. J Infect. 2007, 54: 399-409. 10.1016/j.jinf.2006.06.010View ArticlePubMed
                              25. Martin HM, Hancock JT, Salisbury V, Harrison R: Role of xanthine oxidoreductase as an antimicrobial agent. Infect Immun. 2004, 72: 4933-4939. 10.1128/IAI.72.9.4933-4939.2004PubMed CentralView ArticlePubMed
                              26. Subbaramaiah K, Howe LR, Bhardwaj P, Du B, Gravaghi C, Yantiss RK, Zhou XK, Blaho VA, Hla T, Yang P: Obesity is associated with inflammation and elevated aromatase expression in the mouse mammary gland. Cancer Prev Res (Phila). 2011, 4: 329-346. 10.1158/1940-6207.CAPR-10-0381View Article
                              27. Fiorentino DF, Zlotnik A, Mosmann T, Howard M, O’garra A: IL-10 inhibits cytokine production by activated macrophages. J Immunol. 1991, 147: 3815-3822.PubMed
                              28. Jiang C, Ting AT, Seed B: PPAR-γ agonists inhibit production of monocyte inflammatory cytokines. Nature. 1998, 391: 82-86. 10.1038/34184View ArticlePubMed
                              29. Endres S, Ghorbani R, Kelley VE, Georgilis K, Lonnemann G, van der Meer JW, Cannon JG, Rogers TS, Klempner MS, Weber PC: The effect of dietary supplementation with n-3 polyunsaturated fatty acids on the synthesis of interleukin-1 and tumor necrosis factor by mononuclear cells. N Engl J Med. 1989, 320: 265-271. 10.1056/NEJM198902023200501View ArticlePubMed
                              30. Lublin A, Wolfenson D: Lactation and pregnancy effects on blood flow to mammary and reproductive systems in heat-stressed rabbits. Comp Biochem Physiol A Physiol. 1996, 115: 277-285. 10.1016/S0300-9629(96)00060-6View ArticlePubMed
                              31. Akira S, Uematsu S, Takeuchi O: Pathogen recognition and innate immunity. Cell. 2006, 124: 783-801. 10.1016/j.cell.2006.02.015View ArticlePubMed
                              32. Appel S, Mirakaj V, Bringmann A, Weck MM, Grünebach F, Brossart P: PPAR-γ agonists inhibit toll-like receptor-mediated activation of dendritic cells via the MAP kinase and NF-κB pathways. Blood. 2005, 106: 3888-3894. 10.1182/blood-2004-12-4709View ArticlePubMed
                              33. Liu B-S, Groothuismink ZM, Janssen HL, Boonstra A: Role for IL-10 in inducing functional impairment of monocytes upon TLR4 ligation in patients with chronic HCV infections. J Leukoc Biol. 2011, 89: 981-988. 10.1189/jlb.1210680View ArticlePubMed
                              34. Oliver E, McGillicuddy FC, Harford KA, Reynolds CM, Phillips CM, Ferguson JF, Roche HM: Docosahexaenoic acid attenuates macrophage-induced inflammation and improves insulin sensitivity in adipocytes-specific differential effects between LC n-3 PUFA. J Nutr Biochem. 2012, 23: 1192-1200. 10.1016/j.jnutbio.2011.06.014View ArticlePubMed
                              35. Li H, Ruan XZ, Powis SH, Fernando R, Mon WY, Wheeler DC, Moorhead JF, Varghese Z: EPA and DHA reduce LPS-induced inflammation responses in HK-2 cells: evidence for a PPAR-gamma-dependent mechanism. Kidney Int. 2005, 67: 867-874. 10.1111/j.1523-1755.2005.00151.xView ArticlePubMed
                              36. Edwards IJ, O’Flaherty JT: Omega-3 Fatty Acids and PPARgamma in Cancer. PPAR Res. 2008, 2008: 358052-358052.PubMed CentralView ArticlePubMed
                              37. González-Périz A, Planagumà A, Gronert K, Miquel R, López-Parra M, Titos E, Horrillo R, Ferré N, Deulofeu R, Arroyo V: Docosahexaenoic acid (DHA) blunts liver injury by conversion to protective lipid mediators: protectin D1 and 17S-hydroxy-DHA. FASEB J. 2006, 20: 2537-2539. 10.1096/fj.06-6250fjeView ArticlePubMed
                              38. Wan Y, Saghatelian A, Chong L-W, Zhang C-L, Cravatt BF, Evans RM: Maternal PPARγ protects nursing neonates by suppressing the production of inflammatory milk. Genes Dev. 2007, 21: 1895-1908. 10.1101/gad.1567207PubMed CentralView ArticlePubMed
                              39. Goldman AS, Chheda S, Garofalo R, Schmalstieg FC: Cytokines in human milk: properties and potential effects upon the mammary gland and the neonate. J Mammary Gland Biol Neoplasia. 1996, 1: 251-258. 10.1007/BF02018078View ArticlePubMed
                              40. Miao JF, Zhu YM, Gu BB, Wang XB, Zou SX, Deng YE: Evaluation of the changes of immune cells during lipopolysaccharide-induced mastitis in rats. Cytokine. 2007, 40: 135-143. 10.1016/j.cyto.2007.08.012View ArticlePubMed
                              41. Zhong K: Establishment of experimental mastitis model by endotoxin via teat duct in rat. J Agric Biotechnol. 2005, 13: 654-658.
                              42. Fernandez-Real JM, Broch M, Vendrell J, Ricart W: Insulin resistance, inflammation, and serum fatty acid composition. Diabetes Care. 2003, 26: 1362-1368. 10.2337/diacare.26.5.1362View ArticlePubMed
                              43. Gu B, Miao J, Fa Y, Lu J, Zou S: Retinoic acid attenuates lipopolysaccharide-induced inflammatory responses by suppressing TLR4/NF-κB expression in rat mammary tissue. Int Immunopharmacol. 2010, 10: 799-805. 10.1016/j.intimp.2010.04.022View ArticlePubMed
                              44. Zhu Y, Fossum C, Berg M, Magnusson U: Morphometric analysis of proinflammatory cytokines in mammary glands of sows suggests an association between clinical mastitis and local production of IL-1beta, IL-6 and TNF-alpha. Vet Res. 2007, 38: 871-882. 10.1051/vetres:2007035View ArticlePubMed

                              Copyright

                              © Lin et al.; licensee BioMed Central Ltd. 2013

                              This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.

                              Advertisement