Skip to main content

Table 3 The loci, primer sequences, annealing temperature and the product length of amplified gene

From: Association of GGCX gene polymorphism with warfarin dose in atrial fibrillation population in Xinjiang

Gene locus Primer sequences (5′-3′) Annealing temperature (°C) Product length (bp)
rs2592551 GGACTTAGAAAGGAACGGATGA 61.2 381
  CTTGAGAAAAGGCAAAGCAGAC