Skip to main content

Table 1 Primer sequences

From: Anti-inflammatory effects of fish oil in ovaries of laying hens target prostaglandin pathways

COX-1 Forward 5′TCAGGTGGTTCTGGGACATCA 3′
Reverse 5′ TGTAGCCGTACTGGGAGTTGAA 3′
COX-2 Forward 5′ CTGCTCCCTCCCATGTCAGA 3′
Reverse 5′ CACGTGAAGAATTCCGGTGTT 3′
EP4 Forward 5′ GGTGTTTCATAGACTGGCGA 3′
Reverse 5′ GCAGATCACCGTAACCATGA 3′
SDHA Forward 5′ CAGGGATGTAGTGTCTGCT 3′
Reverse 5′ GGGAATAGGCTCCTTAGTG 3′
TBP Forward 5′ CGTCAGGGAAATAGGCA 3′
Reverse 5′ GACTGGCAGCAAGGAAG 3′
RPL4 Forward 5′ TTATGCCATCTGTTCTGC 3′
Reverse 5′ GCGATTCCTCATCTTACCCT 3′