Skip to main content

Advertisement

Table 4 Real-time PCR primers used in the validation and stimulation tests

From: Microarray analysis provides new insights into the function of apolipoprotein O in HepG2 cell line

Primer Sequence
NFKBIZ F: 5′- GTTGTCTGATGGACCTGC −3′
  R: 5′- CTGTTTGGGTTCATTGAG −3′
FBXL21 F: 5′- TAAGTCCACTCATCCTGATCT −3′
  R: 5′- CAAAATGAGACTCCGACACA −3′
HRB F: 5′- CAAAGAGGACAATCCCAGAG- 3′
  R: 5′- GATCAGGTCCAGGGTTGC −3′
NOTCH2 F: 5′- CCCAATGGGCAAGAAGTCTA −3′
  R: 5′- CACAATGTGGTGGTGGGATA −3′
UCP2 F: 5′- CGGTTACAGATCCAAGGA −3′
  R: 5′- ACCAGCCCATTGTAGAGG −3′
ACSL4 F: 5′- TTGCCATCTTCTGTGAGA −3′
  R: 5′- GGTAATCAGATAGGAAGCC −3′
CEL F: 5′- TATGATCTGGATCTATGGAGG −3′
  R: 5′- CGACACGGTAGTTGAAGGT −3′
APOO F: 5′- GGTGTCAGGAAACGTACTCCC −3′
  R: 5′- AACCCCCATTGAACCAAACTT −3′
GAPDH F: 5′- GGAAGGTGAAGGTCGGAGTC −3′
  R: 5′- GCTCCTGGAAGATGGTGATGG −3′