Skip to main content

Advertisement

Table 4 Methylation patterns analyzed in GCK and HADHB genes

From: Obesity induced by a pair-fed high fat sucrose diet: methylation and expression pattern of genes related to energy homeostasis

Gene Analyzed secuence
GCK GTTAAGGTTAGGAGTTGTTGAGTAATTTTTAAGGTTTTTTTAGAGGTTTTGGTAGATGA
  TATTATTAGTAAAGGGTTTAATTTATGTAGTATTAATATGTTTTC1G GGTGAATAGATTT
  GTATGAGTTTAATGTATATTTATTTTTTAATGGAATTATTTAGGAAGTTAAAGGTTTATT
  TTGTTTTTC2G TTTTATTTAGAAAAAAAAAAAAAAAAAAAAAATTTTAAATTGGTGGTT
  TTAGGTGAAAGTC3G AGTTTTTTTTGAAATTTTGTTGTTTTTTGGTAATTTTTATGTC4G T
  ATTGTTTTTGATC5G GTTTTATTTTTTTGAATAAATATAAGTATTGGTATTTATAGGGTTT
  AAC6G TTTATATTTGTATATTTAC7G TATTGGAGTAGATTTTTAGTATAATGTTTTTTAGT
  TTTTTTTATAGATC8G
HADHB TTTTGTAATTATTATAGTTAGTTGTGAAATTGTTAGGAAC1G TTTATAATAGTGTGTTT
  TTTTTAGTTTTTTTTTTTTTTTTTTTTTTTTTTTC2G GGGTTGGGGATC3G AATTTAGGAT
  TTTGC4G TTTTTTAGGTAAGC5G TTTTATTATTGAGTTAAATTTTTAATTTTTTTTTTTAG
  TTTTTAATTGAAGTAAATTGTTTTTATTGGAGATGTTTTTGTTTGTTAGGGTTGATGTAA
  TATATAAGAATATATTTTATTTTGGTTATTATAAATTTTTTTAAATTTTTGATAATTGTG
  TTATATAATTATATTTATGTTGTGAGAGTTGTAGTTTTAGTTATAGATATTTGTTTGAAT
  GTTGTTTAAATGTATGGAAGTTGTTATTAGAATTATTTTGGTTATTC6G AGTATTTTTAG
  GTAAGGAATA