Skip to main content

Table 2 Primer sequences used in real-time PCR analysis and ChIP assay

From: Lipopolysaccharide significantly influences the hepatic triglyceride metabolism in growing pigs

Target gene Sequence (F: forward, R: reverse) GenBank access Applications
TLR2 F: GACACCGCCATCCTCATTCT NC_010450 PCR
  R: CTTCCCGCTGCGTCTCAT   
TLR4 F: TCTACATCAAGTGCCCCTAC NR_024169.1 PCR
  R: TAAATTCTCCCAAAACCAAC   
TNF-α F:CCACGCTCTTCTGCCTACTGC JF831365.1 PCR
  R:TCGGCTTTGACATTGGCTACAA   
NF-κB F:GGGGACTACGACCTGAATGC EU399817.1 PCR
  R:CACGGTTGTCAAAGATGGG   
IL-1α F:TACTGACTATGGCTACCAA NM_214029.1 PCR
  R:ATTCCAGCTGCTATTGTG   
ACC-1 F:GGCCATCAAGGACTTCAACC NM_001114269.1 PCR
  R:ACGATGTAAGCGCCGAACTT   
FAS F: GTCCTGCTGAAGCCTAACTC EF589048 PCR
  R: TCCTTGGAACCGTCTGTG   
SCD-1 F: CCCAGCCGTCAAAGAGAA NM_213781 PCR
  R: CGATGGCGTAACGAAGAAA   
PPAR-γ F: GCCCTTCACCACTGTTGATT NM_138711 PCR
  R: GAGTTGGAAGGCTCTTCGTG   
C/EBP-β F: GACAAGCACAGCGACGAGTA NM_001199889 PCR
  R: AGCTGCTCCACCTTCTTCTG   
HSL F: ACCCTCGGCTGTCAACTTCTT AY686758 PCR
  R: TCCTCCTTGGTGCTAATCTCGT   
ATGL F: ACCTGTCCAACCTGCTGC EF583921 PCR
  R: GCCTGTCTGCTCCTTTATCCA   
CPT-1α F:ACAACGAGGTCTTCCGAT NM_001129805.1 PCR
  R:AACGCAAAACCACCAAACCC   
ND1 F: TCCTACTGGCCGTAGCATTCCT KF888634.1 PCR
  R: TTGAGGATGTGGCTGGTCGTAG   
ND2 F: ATCGGAGGGTGAGGAGGGCTAA KF888634.1 PCR
  R: GTTGTGGTTGCTGAGCTGTGGA   
ND3 F: AGCACGCCTCCCATTCTCAAT KF888634.1 PCR
  R: TGCTAGGCTTGCTGCTAGTAGG   
ND4 F: TCGCCTATTCATCAGTAAGTCA KF888634.1 PCR
  R: GGATTATGGTTCGGCTGTGTA   
ND4L F: GATCGCCCTTGCAGGGTTACTT KF888634.1 PCR
  R: CTAGTGCAGCTTCGCAGGCT   
ND5 F: CGGATGAGAAGGCGTAGGAA KF888634.1 PCR
  R: GCGGTTGTATAGGATTGCTTGT   
ND6 F: ACTGCTATGGCTACTGAGATGT KF888634.1 PCR
  R: CTTCCTCTTCCTTCAACGCATA   
COX1 F: TGGTGCCTGAGCAGGAATAGTG KF888634.1 PCR
  R: ATCATCGCCAAGTAGGGTTCCG   
COX2 F: GCTTCCAAGACGCCACTTCAC KF888634.1 PCR
  R: TGGGCATCCATTGTGCTAGTGT   
COX3 F: GGCTACAGGGTTTCACGGGTTG KF888634.1 PCR
  R: TCAGTATCAGGCTGCGGCTTCA   
ATP6 F: ACTCATTCACACCCACCACACA KF888634.1 PCR
  R: CCTGCTGTAATGTTGGCTGTCA   
ATP8 F: TGCCACAACTAGATACATCC KF888634.1 PCR
  R: GCTTGCTGGGTATGAGTAG   
CYTB F: CTGAGGAGCTACGGTCATCACA KF888634.1 PCR
  R: GCTGCGAGGGCGGTAATGAT   
PPIA F: TCCTCCTTGGTGCTAATCTCGT NM_214353.1 PCR
  R: TGATCTTCTTGCTGGTCTT   
ACC-1_promoter F: ACAGCATACGGAGTTCCTGG   ChIP
  R: TGTCTTCTGCAACAATGGGA