Skip to main content

Advertisement

Table 1 Primers and fluorescent probes of human apoM, human GAPDH, rat apoM and ratβ-actin

From: Hyperglycemia-induced downregulation of apolipoprotein M expression is not via the hexosamine pathway

Human apoM  
forward primer 5’ TGC CCC GGA AAT GGA TCT A 3’
reverse primer 5’ CAG GGC GGC CTT CAG TT 3’
probe 5’ FAM-CAC CTG ACT GAA GGG AGC ACA GAT CTC A-TAMRA 3’
Human GAPDH  
forward primer 5’GGA AGG TGA AGG TCG GAG TC 3’
reverse prime 5’CGT TCT CAG CCT TGA CGG T 3’
probe 5’FAM- TTT GGT CGT ATT GGG CGC CTG -TAMRA3’
Rat apoM  
forward primer 5’ ACAAAGAGACCCCAGAGCCC 3’
reverse primer 5’ TCCATGGTGGGAGCCG 3’
probe 5’ FAM- ACCTGGGCCTGTGGTACTTTATTGCTGG -TAMRA 3’
Rat β-actin  
forward primer 5’ GCCACTGCCGCATCCTCT 3’
reverse prime 5’ CTGGAAGAGAGCCTCGGGG 3’
probe 5’FAM-AGCTGCCTGACGGTCAGGTCATCACTATC -TAMRA3’