Skip to main content

Table 1 Genes and primers sets for real-time PCR

From: Effect of n-3 fatty acids on the expression of inflammatory genes in THP-1 macrophages

  5’ Forward primer 3’
  Reverse primer
NFKB pathway :  
AKT1 CTCCTGAGGAGCGGGAGGAGTGG
  GTCCACTCCTCCCGCTCCTCAGGA
MAPK TATGGCTCTGTGTGTGCTGCTTTTG
  CAAAAGCAGCACACACAGAGCCAT
NFKB ACAACTATGAGGTCTCTGGGGGTA
  GTACCCCCAGAGACCTCATAGTTGT
Cytokines production :  
TNFA CCATGTTGTAGCAAACCCTCAAGCT
  AGCTTGAGGGTTTGCTACAACATGG
IL1Β CAGATGAAGTGCTCCTTCCAGGACC
  GGTCCTGGAAGGAGCACTTCATCTG
MCP1 CGCTCAGCCAGATGCAATCAATGCC
  GGCATTGATTGCATCTGGCTGAGCG
Fatty acids metabolism :  
ALOX5 GGCATTGATTGCATCTGGCTGAGCG
  CGCTCAGCCAGATGCAATCAATGCC
PTGS2 CTGGGCCATGGGGTGGACTTAAATC
  GATTTAAGTCCACCCCATGGCCCAG
Oxydation system :  
MGST1 TTGACAAGAAAGGTTTTTGCCAATC
  GATTGGCAAAAACCTTTCTTGTCAA
NOS2 CCATGGAACATCCCAAATACGAGT
  CACTCGTATTTGGGATGTTCCATG
HO-1 AAGATTGCCCAGAAAGCCCTGGAC
  AACTGTCGCCACCAGAAAGCTGAG
Housekeeping genes :  
RPL37A  
  GGTGCCTGGACGTACAATACCACTT
  AAGTGGTATTGTACGTCCAGGCACC
18S CCATTGGAGGGCAAGTCTGGTGCC
  TGGCACCAGACTTGCCCTCCAATGG