Skip to main content

Table 1 QPCR primers used in this study

From: Inhibition of NAMPT aggravates high fat diet-induced hepatic steatosis in mice through regulating Sirt1/AMPKα/SREBP1 signaling pathway

Gene Name Forward Reverse
hNAMPT TTGCTGCCACCTTATC AACCTCCACCAGAACC
hFASN AAGGACCTGTCTAGGTTTGATGC TGGCTTCATAGGTGACTTCCA
hSREBP1 CGCAAGGCCATCGACTACAT GACTTAGGTTCTCCTGCTTGAGTTTC
hACC TCGCTTTGGGGGAAATAAAGTG ACCACCTACGGATAGACCGC
hSCD1 GCAGGACGATATCTCTAGCT GTCTCCAACTTATCTCCTCCATTC
hGAPDH CAGGGCTGCTTTTAACTCTGGT GATTTTGGAGGGATCTCGCT
mNAMPT TCGGTTCTGGTGGCGCTTTGCTAC AAGTTCCCCGCTGGTGTCCTATGT
mFASN GGAGGTTGCTTGGAAGAG CTGGATGTGATCGAATGCT
mSREBP1 AGGTGTATTTGCTGGCTTGGT AGAGATGACTAGGGAACTGTGTGT
mACC GGACCACTGCATGGAATGTTAA TGAGTGACTGCCGAAACATCTC
mSCD1 GCTGGGCAGGAACTAGTGAG GAAGGCATGGAAGGTTCAAA
mGAPDH AGCCAAAAGGGTCATCATCT GGGGCCATCCACAGTCTTCT