Skip to main content

Table 2 Primers sequences used for quantitative RT-PCRa

From: Effects of plant essential oil supplementation on growth performance, immune function and antioxidant activities in weaned pigs

Gene Accession no. Primer sequences (5′ - 3′) Product Length, bp
β-actin U07786.1 F:TCTGGCACCACACCTTCT 114
R:TGATCTGGGTCATCTTCTCAC
SOD1 AF396674.1 GATCAAGAGAGGCACGTTGGA 62
GTGGCCACACCATCTTTGC
CAT NM_214 GGACGTGCAGCGCTTCA 52
CCGCACCTGGGTGACATTA
GPX1 NM_214201.1 GGCGGCGGGTTCGA 55
CGCCATTCACCTCACACTTCT
GST Z69586.1 TCCCCACGGTGAAGAAGTTT 57
CGTCAGTGGGAGGCTTCCT
GR AY368271.1 CAGTAGAGGTCAACGGGAAGAAGT 59
GCCGCCTGTGGCAATC
Nrf2 XM_003133500.5 GCCCCTGGAAGCGTTAAAC 67
GGACTGTATCCCCAGAAGGTTGT
Keap-1 NM_001114671.1 ACGACGTGGAGACAGAAACGT 56
GCTTCGCCGATGCTTCA
  1. aSOD1, superoxide dismutase 1; CAT, catalase; GPX1, glutathione peroxidase 1; GST, glutathione transferase; GR, glutathione reductase; Nrf2, nuclear factor E2-related factor 2; Keap-1, Kelch-like ECH-associated protein 1