Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequences of primers used for PCR

From: Increased inflammation, endoplasmic reticulum stress and oxidative stress in endothelial and macrophage cells exacerbate atherosclerosis in ApoCIII transgenic mice

Gene Primer sequences (5′ → 3′)
Human
 MCP1 (Forward) GCTCATAGCAGCCACCTT
(Reverse) GGAATCCTGAACCCACTT
 Chop (Forward) GGAAACAGAGTGGTCATTCCC
(Reverse) CTGCTTGAGCCGTTCATTCTC
 HO-1 (Forward) TTTGAGGAGTTGCAGGAGC
(Reverse) AGGACCCATCGGAGAAGC
 GRP78 (Forward) TCCTATGTCGCCTTCACT
(Reverse) ACAGACGGGTCATTCCAC
 GRP94 (Forward) GTTTGGTGTCGGTTTCTA
(Reverse) GAGTGTTTCCTCTTGGGT
 β-actin (Forward) CGTGGGCCGCCCTAGGCACCA
(Reverse) TTGGCCTTAGGGTTCAGGGGGG
Mouse
 p47 (Forward) ACACCTTCATTCGCCATATTGC
(Reverse) TCGGTGAATTTTCTGTAGACCAC
 p67 (Forward) GCTGCGTGAACACTATCCTGG
(Reverse) AGGTCGTACTTCTTCATTCTGTA
 NOX-2 (Forward) CCAAGGTATCCAAGTT
(Reverse) TCCAGTCTCCCACAAT
 NOX4 (Forward) TAAGCCATCACCATCAT
(Reverse) TGGAGGCAGTAGTAAATC
 Catalase(Forward) AGCGACCAGATGAAGCAG
(Reverse) TTCCCACAAGATCCCAGT
 SOD-1 (Forward) TCCGTCGGCTTCTCGTCT
(Reverse) ACCGCTTGCCTTCTGCTC
 GRP78 (Forward) ACTTGGGGACCACCTATTCCT
(Reverse) GTTGCCCTGATCGTTGGCTA
 IL-6 (Forward) TTCTTGGGACTGATGCTG
(Reverse) CTGGCTTTGTCTTTCTTGTT
 TNF-α (Forward) CTGTGAAGGGAATGGGTGTT
(Reverse) CAGGGAAGAATCTGGAAAGGTC
 IL-10 (Forward) ACCTGGTAGAAGTGATGC
(Reverse) AAGGAGTTGTTTCCGTTA
 TGFβ-1 (Forward) GGCGGTGCTCGCTTTGTA
(Reverse) TCCCGAATGTCTGACGTATTGA