Skip to main content

Table 1 Primer sequences for the RT-PCR

From: Changes in peroxisome proliferator-activated receptor alpha target gene expression in peripheral blood mononuclear cells associated with non-alcoholic fatty liver disease

Gene Primers Sequence (5’-3’) Size (bp)
β-actin Sense GGCTGTATTCCCCTCCATCG 154
Antisense CCAGTTGGTAACAATGCCATGT
Solute carrier family 25 (carnitine/acylcarnitine translocase) member 20 (SLC25A20) Sense GGGGTCACTCCCATGTTTG 135
Antisense TGTGGTGAATACGCCAGATAAC
Pyruvate dehydrogenase kinase isoform 4 (PDK4) Sense GGAGCATTTCTCGCGCTACA 117
Antisense ACAGGCAATTCTTGTCGCAAA
Peroxisome proliferators activated receptors α (PPARα) Sense ATGGTGGACACGGAAAGCC 124
Antisense CGATGGATTGCGAAATCTCTTGG
Carnitine palmitoyltransferase 1B (CPT1B) Sense GCGCCCCTTGTTGGATGAT 112
Antisense CCACCATGACTTGAGCACCAG
acetyl-coenzyme A dehydrogenase 2 (ACAA2) Sense CTGCTCCGAGGTGTGTTTGTA 105
Antisense GGCAGCAAATTCAGACAAGTCA
Acyl-coenzyme A dehydrogenase, long chain (ACADVL) Sense ACAGATCAGGTGTTCCCATACC 114
Antisense CTTGGCGGGATCGTTCACTT
Carnitine palmitoyltransferase 1A (CPT1A) Sense TCCAGTTGGCTTATCGTGGTG 98
Antisense TCCAGAGTCCGATTGATTTTTGC