Skip to main content

Table 2 The primers of qRT-PCR

From: Adenovirus type 36 regulates adipose stem cell differentiation and glucolipid metabolism through the PI3K/Akt/FoxO1/PPARγ signaling pathway

Gene Primer sequence (5′ → 3′)
Human actin-Forward GAGCACAGAGCCTCGCCTTT
Human actin-Reverse GAGCGCGGCGATATCATCA
Human FoxO1-forward GGCTGAGGGTTAGTGAGCAG
Human FoxO1-reverse AAAGGGAGTTGGTGAAAGACA
Human Pparγ-forward GGGATCAGCTCCGTGGATCT
Human Pparγ-reverse TGCACTTTGGATCTCTTGAAGTT
Human Adipoq-forward AACATGCCCATTCGCTTTACC
Human Adipoq-reverse TAGGCAAAGTAGTACAGCCCA
Human Lpin1-forward GCTGGAGAGGGAGAGAGGAT
Human Lpin1-reverse GGTGGCTGCTGTTAGGACA
Human Acc-forward TCCGCACTGACTGTAACCAC
Human Acc-reverse GCGACTTCCATACCGCATTA
Human Glut4-forward TGGGCGGCATGATTTCCTC
Human Glut4-reverse GCCAGGACATTGTTGACCAG
Rattus actin-Forward AGCCATGTACGTAGCCATCC
Rattus actin-Reverse ACCCTCATAGATGGGCACAG
Rattus Acc-forward TACAACGCAGGCATCAGAAG
Rattus Acc-reverse TGTGCTGCAGGAAGATTGAC
Rattus APN-forward AATCCTGCCCAGTCATGAAG
Rattus APN-reverse TCTCCAGGAGTGCCATCTCT
Rattus Lpin1-forward CCATTCACAGCGAGTCTTCA
Rattus Lpin1-reverse TGGAAGGGGAATCTGACTTG
Rattus Glut4-forward GCTTCTGTTGCCCTTCTGTC
Rattus Glut4-reverse TGGACGCTCTCTTTCCAACT