Skip to main content

Table 1 Primer sequences used for the qPCR analysis

From: Antidepressant activity of ω-3 polyunsaturated fatty acids in ovariectomized rats: role of neuroinflammation and microglial polarization

GeneSense Primer (5′-3′)Antisense Primer (5′-3′)
IL-1βAGGTCGTCATCATCCCACGAGGCTGTGGCAGCTACCTATGTCTTG
IL-6CACAAGTCCGGAGAGGAGACACAGTGCATCATCGCTGTTC
TNFαGAGAGATTGGCTGCTGGAACGAGAGATTGGCTGCTGGAAC
IL-10GTTTTACCTGGTAGAAGTGATGCCCCACTGCCTTGCTTTTATTCTC
IL-4ACAGGAGAAGGGACGCCATGAAGCCCTACAGACGAGCTCA
CD86TAGGGATAACCAGGCTCTACCGTGGGTGTCTTTTGCTGTA
iNOSAGTGGCAACATCAGGTCGGCGATGCACAACTGGGTGAAC
CD206AGTTGGGTTCTCCTGTAGCCCAAACTACTACCTGAGCCCACACCTGCT
Arg-1GGGAAAAGCCAATGAACAGCCCAAATGACGCATAGGTCAGG
β-ActinCATCCTGCGTCTGGACCTGGTAATGTCACGCACGATTTCC