Skip to main content

Table 1 Primer and siRNA information

From: Negative correlation between endoglin levels and coronary atherosclerosis

Primer Sequence (5′-3′)
endoglin-siRNA sense GGCCAGCAUUGUCUCACUUTT
endoglin-siRNA antisense AAGUGAGACAAUGCUGGCCTT
Homo-endoglin-F GATCCAGACAAAGTGTGCCG
Homo-endoglin-R AGGATATTGACCACCGCCTC
Homo-SMAD2-F CCAGGTCTCTTGATGGTCGT
Homo-SMAD2-R TTAGGATCTCGGTGTGTCGG
Homo-SMAD3-F ATAACTTGGACCTGCAGCCA
Homo-SMAD3-R ACATTGGAGAGCAGCCCTAG
Homo-SMAD4-F GCTGCTGGAATTGGTGTTGA
Homo-SMAD4-R CTTCGTCTAGGAGCTGGAGG
Homo-BCL2-F TTCTTTGAGTTCGGTGGGGT
Homo-BCL2-R CTTCAGAGACAGCCAGGAGA
Homo-SERPINE1-F ACTGGAAAGGCAACATGACC
Homo-SERPINE1-R TGACAGCTGTGGATGAGGAG
Homo-CCL2-F TCTGTGCCTGCTGCTCATAG
Homo-CCL2-R CAGATCTCCTTGGCCACAAT