Skip to main content

Advertisement

Table 1 Forward and reverse primer sequences used for qRT-PCR measurements synthesized by Integrated DNA Technologies (Coralville, IA)

From: Conjugated linoleic acid or omega 3 fatty acids increase mitochondrial biosynthesis and metabolism in skeletal muscle cells

Gene Forward primer 5→ 3 Reverse primer 5→ 3
PGC-1α ACCAAACCCACAGAGAACAG GGGTCAGAGGAAGAGATAAAGTTG
GLUT4 AAGAATCCCTGCAGCCTGGTAGAA CCACGGCCAAACCACAACACATAA
Irisin AGGTGCTTTACCGCTGTACCTTCA AGAGAGGGCCAGATGTTTGTTGGA
TBP CACGAACCACGGCACTGATT TTTTCTTGCTGCCAGTCTGGAC