- Research
- Open Access
- Published:
Association study of angiotensin converting enzyme gene polymorphism with elderly diabetic hypertension and lipids levels
Lipids in Health and Disease volumeĀ 12, ArticleĀ number:Ā 187 (2013)
Abstract
Objective
To investigate the relationship between angiotensin converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism and diabetic essential hypertension in elderly population.
Methods
Polymerase chain reaction (PCR) technique was used in 260 elderly normal control patients, 205 elderly hypertensive patients and 138 elderly diabetic hypertensive patients to detect the I/D polymorphism in ACE gene.
Results
DD genotype frequency (0.352) and D allele frequency (0.543) in elderly hypertensive patients were higher than those in the normal control patients. DD genotype (0.421) and D allele frequency (0.579) in elderly diabetic hypertensive patients were significantly higher than those in the control patients (0.133 and 0.250). The differences of DD genotype and D allele frequency between the elderly hypertensive patients and the elderly diabetic hypertensive patients were not significant (Pā>ā0.05).
Conclusion
ACE gene deletion is a risk factor for hypertension but is not a risk factor for diabetes in elderly population.
Introduction
ACE is an important component of the renin - angiotensin system and plays an important role in hypertension and other cardiovascular and cerebrovascular diseases [1]. Type 2 diabetes is a polygenic complex disease caused by genetic factors and environmental factors [2], and the genetic factors are quite essential in the development of type 2 diabetes [3]. Many studies showed that the genetic polymorphisms of some genes related to metabolism were associated with type 2 diabetes [4], and the ACE gene polymorphism was one of them. There is a 287Ā bp DNA fragment insertion (insertion, I)/deletion (deletion, D) polymorphism in intron 16 of ACE gene [5], which was studied in-depth in more and more basic researches [6ā10]. And the association between the ACE gene polymorphism and the pathology of hypertension or diabetes has been paid more attention recently [7ā9, 11ā15]. The present study aimed to explore the association of ACE gene polymorphism with hypertensive patients and with diabetic hypertension patients in elderly population in China.
Subjects and methods
Subjects
260 subjects were enrolled in the elderly control group (Male, nā=ā150, Female, nā=ā110), whose age were from 75 to 85Ā years (81.6ā±ā4.55Ā years). They were admitted to our hospital for medical examination and routine treatment from the October 2006 to March 2013. They did not have hypertension, diabetes, coronary heart disease or any other cardiovascular disease.
205 patients were enrolled in elderly hypertensive group (Male, nā=ā103, Female, nā=ā102), whose age were from 74 to 86Ā years (79.8ā±ā6.28Ā years). Diagnosis of essential hypertension was defined according to the WHO diagnostic criteria of hypertension, namely as systolic blood pressureāā„ā140Ā mmHg, diastolic blood pressureāā„ā90Ā mmHg.
138 patients were enrolled in elderly diabetic hypertension group (Male, nā=ā70, Female, nā=ā68, whose age were from 75 to 83Ā years (79.12ā±ā5.21Ā years). Diagnosis of diabetes is defined in accordance with the clinical criteria for diabetes.
Methods
Ethical statement
The present study has been performed with the approval of the ethics committee of General Hospital of the Air Force PLA and is in compliance with the Helsinki Declaration.
Extraction of DNA template
The rapid DNA extraction kit (Jinan Xinbeixi Biotechnology Co., Ltd. Jinan, China) was used for the extraction of the template DNA according to the protocol of the Kit.
PCR amplification of the target fragment
Genotyping was conducted in accordance with kit instructions of the ACE gene I/D polymorphism assay (Jinan Xinbeixi Biotechnology Co., Ltd., Jinan, China). The primers sequences as follows: Upstream: 5āCCCAGGCCGGGGACTCTGTA-3ā; Downstream:5āAGCTCCAGCCCTTAGCTCACCT3ā. Genomic DNA, dNTPs and TaqDNA polymerase were used for PCR mixture and each primer were used for ACE. The PCR steps were as the following: initial denaturation step at 94°C for 4Ā minutes, followed by 36Ā cycles of denaturation at 94°C for 50Ā seconds, annealing at 58°C for 30Ā seconds, extension at 72°C for 60Ā seconds and a final extension at 72°C for 5Ā minutes. Amplified products had two fragments: fragment with length of 490Ā bp was defined I allele, fragment with length of 190Ā bp was defined D allele. II genotype had only 1 band of 490Ā bp, ID genotype had both 490Ā bp and 190Ā bp bands, DD genotype had 1 band of 190Ā bp (FigureĀ 1).
Statistical analysis
SPSS 13.0 software was utilized for the data analysis, The genotype frequencies and the allele frequencies of ACE gene among groups were compared using Ļ 2 test, P <0.05 was considered significant difference.
Results
Hardy-Weinberg equilibrium test
ACE genotype distributions in three groups were in line with Hardy-Weinberg equilibrium (all Pā>ā0.05, data not shown).
Genotype distribution
Compared to the healthy control group, the frequency of ID and DD genotype was significantly higher in both elderly hypertensive patients group and in elderly hypertension with diabetes group (P <0.001). Similarly, the D allele frequency was also higher in these two groups comparing to the control group. We did not find significant significance between elderly hypertensive group and elderly hypertension with diabetes group in genotype or allele frequency (TableĀ 1).
Serum glucose and lipid levels in different genotypes
TG and LDL-C levels in patients with ID and DD genotype were significantly higher than those in patients with II genotype, the difference of blood glucose levels were not statistically significant in different genotypes (Pā>ā0.05), TableĀ 2.
Discussion
Epidemiological studies show that the hypertension is a polygenic disease, and the genetic and environmental factors were involved in the pathogenesis of hypertension together. ACE is the key enzyme in renin - angiotensin system, which can catalyze the conversion of angiotensinI to angiotensin II and is the ACE protein coding gene [2, 15]. ACE gene exists in chromosome 17q23 and contains 26 exons and 25 introns with a total length of 21Ā kb. Accordance with the presence or absence of 287Ā bp fragment in intron 16, there is an insertion/deletion (I/D) polymorphism. Some studies confirmed the presence of three genotypes: deletion homozygous genotype DD, insertion homozygous genotype II and heterozygous genotype ID.
Type 2 diabetes is a complex polygenic disease caused by genetic factors and environmental factors, of which, the genetic factors play the important role in the development of type 2 diabetes [3]. In recent years, the relationship between ACE gene polymorphism and type 2 diabetes was inconsistent among different reports. For example, in a recent published meta-analysis [16] report showed that a total of 41 studies including 4708 cases and 5368 controls were pool analyzed the association between ACE I/D polymorphism and T2DM in a Chinese population. The authors found the pooled ORs for the association between ACE I/D polymorphism and T2DM risk were not statistically significant under all genetic models (co-dominant model: DD vs. II: ORā=ā1.17, 95% CI 0.97-1.42 and ID vs. II: ORā=ā1.01, 95% CI 0.93-1.10; dominant model: ORā=ā1.06, 95% CI 0.94-1.19; multiplicative model: ORā=ā1.08, 95% CI 0.98-1.18). However, Zarouk et al. [17] reported that the DD genotype and the D allele are associated with hypertension and type 2 diabetes in Egyptian patients.
In the present study, we utilized the case - control study to analyze the relationship between the ACE gene polymorphism and elderly hypertension and diabetic hypertension. The role of ACE gene in essential hypertension remained controversial. Woo et al. [18] reported ACE gene was not observed to be associated with essential hypertension. However, in another population-based study, the D allele was found to be associated with hypertension [19]. In addition, Kenric et al. also found that the D allele was associated with hypertension in a group of African Americans [20].
In this study, between elderly hypertensive group, elderly hypertensive with diabetes group and healthy control group, the frequencies of ID and DD genotype in ACE gene, as well as the frequency of D allele, were significantly increased. Indicating that ACE gene deletion polymorphism was associated with the pathogenesis of hypertension in elderly. The present study also found that the ACE gene I/D polymorphism was not a risk factor for type 2 diabetes in the elderly population, which was consistent with some reports [21ā23]. In addition, this study also found that in the different genotypes, TG and LDL-C levels in D allele carriers significantly increased, but it had no effect on blood glucose levels. The mechanism of ACE gene polymorphism affects the lipid levels was unclear, which is worth further exploring.
Conclusion
In summary, in Chinese elderly population, DD genotype and D allele in ACE gene were associated with hypertension and lipid levels. However, they were not risk factors for type 2 diabetes in Chinese elderly population.
References
Xia H, Sriramula S, Chhabra KH, Lazartigues E: Brain Angiotensin-converting enzyme type 2 shedding contributes to the development of neurogenic hypertension. Circ Res. 2013, 113 (9): 1087-96. 10.1161/CIRCRESAHA.113.301811
Chaoxin J, Daili S, Yanxin H, Ruwei G, Chenlong W, Yaobin T: The influence of angiotensin-converting enzyme 2 gene polymorphisms on type 2 diabetes mellitus and coronary heart disease. Eur Rev Med Pharmacol Sci. 2013, 17 (19): 2654-9.
Wang CH, Ke WS, Lin E: Evaluation of the ENPP1 and PLIN single nucleotide polymorphisms with type 2 diabetes in a Taiwanese population: evidence for replication and gene-gene interaction. J Investig Med. 2012, 60 (8): 1169-73.
MuƱoz-Barrios S, GuzmƔn-GuzmƔn IP, MuƱoz-Valle JF, Salgado-BernabƩ AB, Salgado-Goytia L, Parra-Rojas I: Association of the HindIII and S447X polymorphisms in LPL gene with hypertension and type 2 diabetes in Mexican families. Dis Markers. 2012, 33 (6): 313-20. 10.1155/2012/673452
Zarouk WA, Hussein IR, Esmaeil NN, Raslan HM, Reheim HA, Moguib O, Emara NA, Aly AA, Hamed M: Association of angiotensin converting enzyme gene (I/D) polymorphism with hypertension and type 2 diabetes. Bratisl Lek Listy. 2012, 113 (1): 14-8.
Al-Rubeaan K, Siddiqui K, Saeb AT, Nazir N, Al-Naqeb D, Al-Qasim S: ACE I/D and MTHFR C677T polymorphisms are significantly associated with type 2 diabetes in Arab ethnicity: a meta-analysis. Gene. 2013, 520 (2): 166-77. 10.1016/j.gene.2013.02.017
Al-Harbi EM, Farid EM, Gumaa KA, Darwish AH, Alenizi M, Singh J: Genetic combination of angiotensin-converting enzyme with methylene tetrahydrofolate reductase polymorphisms and the risk of type 2 diabetes mellitus in Bahrain. J Renin Angiotensin Aldosterone Syst. 2013, doi: 10.1177/1470320313478286
Purnamasari D, Widjojo BD, Antono D, Syampurnawati M: ACE gene polymorphism and atherosclerotic lesion of carotid artery among offsprings of type 2 diabetes mellitus. Acta Med Indones. 2012, 44 (2): 128-34.
Narne P, Ponnaluri KC, Singh S, Siraj M, Ishaq M: Relationship between angiotensin-converting enzyme gene insertion/deletion polymorphism, angiographically defined coronary artery disease and myocardial infarction in patients with type 2 diabetes mellitus. J Renin Angiotensin Aldosterone Syst. 2012, 13 (4): 478-86. 10.1177/1470320312448947
Mansoor Q, Javaid A, Bilal N, Ismail M: Angiotensin-converting enzyme (ACE) gene II genotype protects against the development of diabetic peripheral neuropathy in type 2 diabetes mellitus. J Diabetes. 2012, 4 (3): 257-61. 10.1111/j.1753-0407.2012.00205.x
Sinorita H, Madiyan M, Pramono RB, Purnama LB, Ikhsan MR, Asdie AH: ACE gene insertion/deletion polymorphism among patients with type 2 diabetes, and its relationship with metabolic syndrome at Sardjito Hospital Yogyakarta, Indonesia. Acta Med Indones. 2010, 42 (1): 12-6.
Niu W, Qi Y, Gao P, Zhu D: Angiotensin converting enzyme D allele is associated with an increased risk of type 2 diabetes: evidence from a meta-analysis. Endocr J. 2010, 57 (5): 431-8. 10.1507/endocrj.K09E-360
Chmaisse HN, Jammal M, Fakhoury H, Fakhoury R: A study on the association between angiotensin-I converting enzyme I/D dimorphism and type-2 diabetes mellitus. Saudi J Kidney Dis Transpl. 2009, 20 (6): 1038-46.
Rasyid H, Bakri S, Yusuf I: Angiotensin-converting enzyme gene polymorphisms, blood pressure and pulse pressure in subjects with essential hypertension in a South Sulawesi Indonesian population. Acta Med Indones. 2012, 44 (4): 280-3.
Zhu M, Zhang J, Nie S, Yan W: Associations of ACE I/D, AGT M235T gene polymorphisms with pregnancy induced hypertension in Chinese population: a meta-analysis. J Assist Reprod Genet. 2012, 29 (9): 921-32. 10.1007/s10815-012-9800-4
Zhou D, Ruiter R, Zhang J, Zhou M, Liu H, Liu W, Wang S: Angiotensin-converting enzyme I/D polymorphism is not associated with type 2 diabetes in a Chinese population. J Renin Angiotensin Aldosterone Syst. 2012, 13: 372-8. 10.1177/1470320311435535
Bhaskar LV, Mahin S, Ginila RT, Soundararajan P: Role of the ACE ID and PPARG P12A Polymorphisms in Genetic Susceptibility of Diabetic Nephropathy in a South Indian Population. Nephrourol Mon. 2013, 5 (3): 813-817. 10.5812/numonthly.9573
Woo SW, Bang S, Chung MW, Jin SK, Kim YS, Lee SH: Lack of association between ACE and bradykinin B2 receptor gene polymorphisms and ACE inhibitor-induced coughing in hypertensive Koreans. J Clin Pharm Ther. 2009, 34 (5): 561-7. 10.1111/j.1365-2710.2009.01028.x
He Q, Fan C, Yu M, Wallar G, Zhang ZF, Wang L, Zhang X, Hu R: Associations of ACE Gene Insertion/Deletion Polymorphism, ACE Activity, and ACE mRNA Expression with Hypertension in a Chinese Population. PLoS One. 2013, 8 (10): e75870- 10.1371/journal.pone.0075870
Zivko M, Kusec R, GalesiÄ K: Impact of angiotensin-converting enzyme gene polymorphism on proteinuria and arterial hypertension. Coll Antropol. 2013, 37: 765-770.
Arfa I, Nouira S, Abid A, Bouafif-Ben Alaya N, Zorgati MM, Malouche D, Manai I, Ben Rayana MC, Blousa-Chabchoub S, Ben Romdhane H, Ben Ammar MS, Ben Salah A, Abdelhak S: Lack of association between renin-angiotensin system (RAS) polymorphisms and hypertension in Tunisian type 2 diabetics. Tunis Med. 2010, 88 (1): 38-41.
Tascilar N, Dursun A, Ankarali H, Mungan G, Ekem S, Baris S: Angiotensin-converting enzyme insertion/deletion polymorphism has no effect on the risk of atherosclerotic stroke or hypertension. J Neurol Sci. 2009, 285 (1ā2): 137-41.
Arfa I, Abid A, Nouira S, Elloumi-Zghal H, Malouche D, Mannai I, Zorgati MM, Ben Alaya N, Rebai A, Zouari B, Ben Ammar S, Ben Rayana MC, Hmida S, Blousa-Chabchoub S, Abdelhak S: Lack of association between the angiotensin-converting enzyme gene (I/D) polymorphism and diabetic nephropathy in Tunisian type 2 diabetic patients. J Renin Angiotensin Aldosterone Syst. 2008, 9 (1): 32-6. 10.3317/jraas.2008.002
Author information
Authors and Affiliations
Corresponding author
Additional information
Competing interests
The authors declared no competing interests exist.
Authorsā contributions
YFZ and HLL carried out the molecular genetic studies and drafted the manuscript. HY and JZ carried out the genotyping. QX, JJL, and XYZ participated in the design of the study and performed the statistical analysis. YYL conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.
Authorsā original submitted files for images
Below are the links to the authorsā original submitted files for images.
Rights and permissions
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( https://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated.
About this article
Cite this article
Zhou, YF., Yan, H., Hou, XP. et al. Association study of angiotensin converting enzyme gene polymorphism with elderly diabetic hypertension and lipids levels. Lipids Health Dis 12, 187 (2013). https://doi.org/10.1186/1476-511X-12-187
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/1476-511X-12-187
Keywords
- Angiotensin converting enzyme gene
- Insertion/deletion polymorphism
- Elderly
- Hypertension
- Diabetic hypertension